Hemizygous

Describes an individual who has only one member of a chromosome pair or chromosome segment rather than the usual two;
refers in particular to X-linked genes in males who under usual circumstances have only one X chromosome.

Minus and plus strand

ACTGGCGGCCATGGAACTCACCG

X - 15353623 15353645

SO this mapped to the minus strand

To match the plus strand, first reverse the sequence to:

GCCACTCAAGGTACCGGCGGTCA

Then compliment the reversed sequence to:

CGGTGAGTTCCATGGCCGCCAGT

Then it will be mapped to:

X + 15353623 15353645