Clipped alignment. In Smith-Waterman alignment, a sequence may not be aligned from the first residue to the last one. Subsequences at the ends may be clipped off. We introduce operation ʻSʼ to describe (softly) clipped alignment. Here is an example. Suppose the clipped alignment is:
REF:AGCTAGCATCGTGTCGCCCGTCTAGCATACGCATGATCGACTGTCAGCTAGTCAGACTAGTCGATCGATGTG
READ: gggGTGTAACC-GACTAGgggg
where on the read sequence, bases in uppercase are matches and bases in lowercase are clipped off. The CIGAR for this alignment is: 3S8M1D6M4S.
No comments:
Post a Comment